*Target (protein/gene name): Phosphatidylglycerophosphatase B *NCBI Gene # or RefSeq#: 444351067 *Protein ID (NP or XP #) or Wolbachia#: YP_007387211.1 *Organism (including strain): Enterobacter aerogenes Etiologic Risk Group (see link below): Escherichia coli - all enteropathogenic, enterotoxigenic, enteroinvasive and strains bearing K1 antigen, including E. coli O157:H7
*Background/Disease Information (sort of like the Intro to your Mini Research Write up):
Enterobacter aerogenes is a gram-negative, pathogenic bacteria that is commonly found in urinary and digestive tract infections. This bacterium is of special importance because of its ability to easily develop antibiotic resistance to common drugs. This has caused the pathogen to be frequently found in hospitals, where it has the ability to mutate to resist current antibiotics and other drugs. The bacterium does this by developing several pump-like mechanisms that push out harmful molecules from its cytosol. One of these pumps specifically uses a proton motive force to thrust out detergents disinfectants and antibiotics from the cell. It is because of these unique mechanisms the bacterium develops to become resistant to antibiotics that makes this a good target for virtual screening. If a specific essential protein, such as Phosphatidylglycerophosphatase B, can be identified and shut off in the organism then it can be degraded without the risk of having it develop antibiotic resistance. (http://aac.asm.org/content/46/8/2640.full)
Enzyme Assay information (spectrophotometric, coupled assay ?, reagents): decarboxylase -- link to Sigma (or other company) page for assay or assay reagents (substrates) -- link (or citation) to paper that contains assay information
J Bacteriol. 1977 October; 132(1): 159–165.
PMCID: PMC221840
Intracellular Distribution of Enzymes of Phospholipid Metabolism in Several Gram-Negative Bacteria -- List cost and quantity of substrate reagents and supplier
Anti-PGS1 (AB1) antibody produced in rabbit, Sigma, $335
Structure Available (PDB or Homology model) -- PDB # or closest PDB entry if using homology model: No structure found -- For Homology Model option: ---- Show pairwise alignment of your BLASTP search in NCBI against the PDB ---- Query Coverage: ---- Max % Identities: ---- % Positives ---- Chain used for homology:
Current Inhibitors: Expression Information (has it been expressed in bacterial cells): No information was found about expression in other bacterial cells, but according to the paper referenced, the organism (Enterobacter aerogenes) shares a 78% overall sequence identity in a 215-amino-acid (aa) overlap. This should mean that it would relatively easy to express the Phosphatidylglycerophosphatase B protein in a common bacteria such as E. Coli.
*length of your protein in Amino Acids 252 aa Molecular Weight of your protein in kiloDaltons using the Expasy ProtParamwebsite: 28828.3 Molar Extinction coefficient of your protein at 280 nm wavelength:
Ext. coefficient 102105
Abs 0.1% (=1 g/l) 3.542, assuming all pairs of Cys residues form cystines
Ext. coefficient 101980
Abs 0.1% (=1 g/l) 3.537, assuming all Cys residues are reduced TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it. *CDS Gene Sequence (paste as text only):
gi|444350194:919247-920005 Enterobacter aerogenes EA1509E, complete genome
GCGGCCCGTTAACCCCGCCTGTTGAAGAGGCGAGCGATATCAAAAAACGCGCAACCTGA *GC% Content for gene: 55.6% *CDS Gene Sequence (codon optimized) - copy from output of Primer Design Protocol (paste as text only): *GC% Content for gene (codon optimized):
*NCBI Gene # or RefSeq#: 444351067
*Protein ID (NP or XP #) or Wolbachia#: YP_007387211.1
*Organism (including strain): Enterobacter aerogenes
Etiologic Risk Group (see link below): Escherichia coli - all enteropathogenic, enterotoxigenic, enteroinvasive and strains bearing K1 antigen, including E. coli O157:H7
*Background/Disease Information (sort of like the Intro to your Mini Research Write up):
Enterobacter aerogenes is a gram-negative, pathogenic bacteria that is commonly found in urinary and digestive tract infections. This bacterium is of special importance because of its ability to easily develop antibiotic resistance to common drugs. This has caused the pathogen to be frequently found in hospitals, where it has the ability to mutate to resist current antibiotics and other drugs. The bacterium does this by developing several pump-like mechanisms that push out harmful molecules from its cytosol. One of these pumps specifically uses a proton motive force to thrust out detergents disinfectants and antibiotics from the cell. It is because of these unique mechanisms the bacterium develops to become resistant to antibiotics that makes this a good target for virtual screening. If a specific essential protein, such as Phosphatidylglycerophosphatase B, can be identified and shut off in the organism then it can be degraded without the risk of having it develop antibiotic resistance.
(http://aac.asm.org/content/46/8/2640.full)
Essentiality of this protein: In phospholipid synthesis/metabolism
Complex of proteins?: No
Druggable Target: phosphatidic acid (http://books.google.com/books?hl=en&lr=&id=sqp91vnUnaQC&oi=fnd&pg=PA215&dq=Phosphatidylglycerophosphatase+Enterobacter+aerogenes&ots=cdxKc1NYfu&sig=buVtgLc9DbB7qzMa3IY7HGGDTJE#v=onepage&q=Phosphatidylglycerophosphatase%20&f=false)
*EC#: 3.1.3.27
Link to BRENDA EC# page:
http://www.brenda-enzymes.org/php/result_flat.php4?ecno=3.1.3.27
-- Show screenshot of BRENDA enzyme mechanism schematic
Enzyme Assay information (spectrophotometric, coupled assay ?, reagents): decarboxylase
-- link to Sigma (or other company) page for assay or assay reagents (substrates)
-- link (or citation) to paper that contains assay information
J Bacteriol. 1977 October; 132(1): 159–165.
PMCID: PMC221840
Intracellular Distribution of Enzymes of Phospholipid Metabolism in Several Gram-Negative Bacteria
-- List cost and quantity of substrate reagents and supplier
Anti-PGS1 (AB1) antibody produced in rabbit, Sigma, $335
Structure Available (PDB or Homology model)
-- PDB # or closest PDB entry if using homology model: No structure found
-- For Homology Model option:
---- Show pairwise alignment of your BLASTP search in NCBI against the PDB
---- Query Coverage:
---- Max % Identities:
---- % Positives
---- Chain used for homology:
Current Inhibitors:
Expression Information (has it been expressed in bacterial cells): No information was found about expression in other bacterial cells, but according to the paper referenced, the organism (Enterobacter aerogenes) shares a 78% overall sequence identity in a 215-amino-acid (aa) overlap. This should mean that it would relatively easy to express the Phosphatidylglycerophosphatase B protein in a common bacteria such as E. Coli.
(http://aac.asm.org/content/46/8/2640.full)
Purification Method:
Ion-exchange chromatography and Sephadex G-100 filtration
(http://books.google.com/books?hl=en&lr=&id=sqp91vnUnaQC&oi=fnd&pg=PA215&dq=Phosphatidylglycerophosphatase+Enterobacter+aerogenes&ots=cdxKc1NYfu&sig=buVtgLc9DbB7qzMa3IY7HGGDTJE#v=snippet&q=purification&f=false)
Image of protein (PyMol with features delineated and shown separately):
Protein shown in Mus musculus (could not be found in Enterobacter aerogenes)
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):
1 mlliakrtai gaalllvmpv ivwlsgwqwq pgqapamlkm wywvtetvtq pwgiithval
61 fgwflwclrf rlrealvlfl ilgaailagq glkswikerv qeprpfviwl ertqqvpvaq
121 fyelkrkera klvheqlaeq qtipgflrkh wqketgfafp sghtmfaasw allgvgllwp
181 rrrwvtigll lgwatavmgs rlalgmhwpq dlivatslsw llvtaatwlt qrfcgpltpp
241 veeasdikkr at
*length of your protein in Amino Acids 252 aa
Molecular Weight of your protein in kiloDaltons using the Expasy ProtParamwebsite: 28828.3
Molar Extinction coefficient of your protein at 280 nm wavelength:
Ext. coefficient 102105
Abs 0.1% (=1 g/l) 3.542, assuming all pairs of Cys residues form cystines
Ext. coefficient 101980
Abs 0.1% (=1 g/l) 3.537, assuming all Cys residues are reduced
TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it.
*CDS Gene Sequence (paste as text only):
gi|444350194:919247-920005 Enterobacter aerogenes EA1509E, complete genome
ATGCTGTTGATTGCCAAAAGGACCGCCATCGGGGCGGCGCTATTGCTTGTTATGCCCGTTATAGTCTGGC
TCTCCGGCTGGCAGTGGCAGCCGGGTCAAGCACCGGCTATGTTGAAAATGTGGTACTGGGTGACTGAAAC
CGTCACCCAGCCGTGGGGAATAATTACTCACGTAGCGCTATTTGGCTGGTTTTTGTGGTGTTTACGATTT
CGTCTGCGCGAAGCGCTGGTGCTGTTTCTCATTCTCGGCGCCGCTATCCTGGCAGGACAGGGGCTTAAAT
CCTGGATCAAAGAACGGGTGCAGGAACCACGGCCGTTTGTGATTTGGTTAGAACGAACCCAACAGGTTCC
GGTGGCGCAATTCTATGAGTTAAAACGTAAAGAACGCGCTAAACTGGTGCATGAGCAATTGGCTGAACAA
CAGACAATACCGGGGTTCTTGCGTAAACACTGGCAAAAAGAGACCGGTTTTGCCTTTCCGTCCGGCCATA
CCATGTTTGCCGCCAGTTGGGCGCTACTGGGGGTAGGGCTGTTGTGGCCGCGCCGGCGCTGGGTAACTAT
CGGTTTGCTGTTGGGTTGGGCTACTGCGGTCATGGGCAGTCGTCTGGCGTTGGGCATGCACTGGCCGCAG
GATCTTATCGTGGCGACCAGCCTTTCATGGCTGCTGGTTACCGCAGCGACCTGGCTCACGCAGCGTTTTT
GCGGCCCGTTAACCCCGCCTGTTGAAGAGGCGAGCGATATCAAAAAACGCGCAACCTGA
*GC% Content for gene: 55.6%
*CDS Gene Sequence (codon optimized) - copy from output of Primer Design Protocol (paste as text only):
*GC% Content for gene (codon optimized):